Msgm Woman Sequined Stretchknit Mini Dress Black Size 38 Msgm HquaR51Y5s

SKU869757217650194462635
Msgm Woman Sequined Stretch-knit Mini Dress Black Size 38 Msgm HquaR51Y5s
Msgm Woman Sequined Stretch-knit Mini Dress Black Size 38 Msgm
Riverton City
Utah
79°
Mostly Sunny
cropped trousers Green Nili Lotan nCj2vbE8n9
Staff Directory hitop zip sneakers White Diesel 8UI48u
slim fit jeans Black Dsquared2 wKN2sSt
Emergency Spills Illegal Dumping Hotline

When Diana died, a crack appeared in a vial of grief, and released a salt ocean. A nation took to the boats. Vast crowds gathered to pool their dismay and sense of shock. As Diana was a collective creation, she was also a collective possession. The mass-mourning offended the taste police. It was gaudy, it was kitsch – the rotting flowers in their shrouds, the padded hearts of crimson plastic, the teddy bears and dolls and broken-backed verses. But all these testified to the struggle for self-expression of individuals who were spiritually and imaginatively deprived,who released their own suppressed sorrow in grieving for a woman they did not know. The term “mass hysteria” was a facile denigration of a phenomenon that eluded the commentators and their framework of analysis. They did not see the active work the crowds were doing. Mourning is work. It is not simply being sad. It is naming your pain. It is witnessing the sorrow of others, drawing out the shape of loss. It is natural and necessary and there is no healing without it.

Facebook Twitter Pinterest

It is irrelevant to object that Diana alive bore no resemblance to Diana dead. The crowds were not deluded about what they had lost. They were not mourning something perfect, but something that was unfinished. There was speculation that Diana might have been pregnant when she died. Was something of startling interest evolving beneath her skin – another way of living? The question was left hanging. Her death released subterranean doubts and fear. Even those who scorn conspiracy theories asked, what exactly is an accident? Why, on the last night of her life, did Diana go below ground to reach her destination? She need not have gone that way. But she didn’t choose – she was driven. Her gods wanted her: she had been out too late.

From her first emergence in public, sun shining through her skirt, Diana was exploited, for money, for thrills, for laughs. She was not a saint, or a rebel who needs our posthumous assistance – she was a young woman of scant personal resources who believed she was basking with dolphins when she was foundering among sharks. But as a phenomenon, she was bigger than all of us: self-renewing as the seasons, always desired and never possessed. She was the White Goddess evoked by Robert Graves, the slender being with the hook nose and startling blue eyes; the being he describes as a shape-shifter, a virgin but also a vixen, a hag, mermaid, weasel. She was Thomas Wyatt’s white deer, fleeing into the forest darkness. She was the creature “painted and damned and young and fair”, whom the poet Stevie Smith described:

I wonder why I fear so much What surely has no modern touch?

In the TV broadcast last month, Prince William said, “We won’t be doing this again. We won’t speak openly or publicly about her again …” When her broken body was laid to rest on a private island, it was a conscious and perhaps superfluous attempt to embed her in national myth. No commemorative scheme has proved equal or, you might think, necessary. She is like John Keats, but more photogenic: “Here lies one whose name was writ in water.” If Diana is present now, it is in what flows and is mutable, what waxes and wanes, what cannot be fixed, measured, confined, is not time-bound and so renders anniversaries obsolete: and therefore, possibly, not dead at all, but slid into the Alma tunnel to re-emerge in the autumn of 1997, collar turned up, long feet like blades carving through the rain.

One Star Ox Plimsolls In Blue 159768C Blue Converse diQ5x5Z

Top Menu

Ash User

Leading the way in experimental and clinical research in hematology

Advanced Search

Advertisement

Stuart J. D. Neil , Áine McKnight , Kenth Gustafsson and Robin A. Weiss
Blood 2005 105:4693-4699; doi: https://doi.org/10.1182/blood-2004-11-4267
Stuart J. D. Neil
Áine McKnight
Kenth Gustafsson
Robin A. Weiss

Abstract

ABO histo-blood group antigens have been postulated to modify pathogen spread through the action of natural antibodies and complement. The antigens are generated by a polymorphic glycosyl-transferase encoded by 2 dominant active and a recessive inactive allele. In this study we investigated whether ABO sugars are incorporated into the envelope of HIV-1 virions. HIV vectors derived from cells expressing ABO antigens displayed sensitivity to fresh human serum analogous to ABO incompatibility, and ABO histo-blood group sugars were detected on the viral envelope protein, glycoprotein 120 (gp120). Moreover, lymphocyte-derived virus also displayed serum sensitivity, reflecting the ABO phenotype of the host when cultured in autologous serum due to adsorption of antigens to cell surfaces. Serum sensitivity required both active complement and specific anti-ABO antibodies. Thus, incorporation of ABO antigens by HIV-1 may affect transmission of virus between individuals of discordant blood groups by interaction with host natural antibody and complement. (Blood. 2005;105:4693-4699)

Introduction

The ABO blood group system, discovered by Landsteiner more than a century ago, is one of the best-studied polymorphic genetic loci in the human genome. The blood group, a carbohydrate antigen, is synthesized by allelic forms of a single glycosyltransferase that catalyses the addition of -acetylgalactosamine (A) or d -galactose (B) to a core fucosylated oligosaccharide generated by the H transferase (fucosyltransferase 1; FUT1) product of the gene; the O group is found in individuals homozygous for a prematurely truncated form of the ABO transferase and displays the H phenotype without A or B. ABO antigens are incorporated into the surface glycoproteins and glycolipids of red blood cells. Also free glycolipids in the serum bearing ABO sugars can be incorporated into membranes of other cells and tissues, including lymphocytes that do not normally express the glycosyltransferases. In more than 80% of individuals in which the blood group is present in secretions, ABO antigens are expressed on epithelial mucosae, including those of the male and female genital tract. The secretor phenotype is defined by the activity of a separate H synthesizing enzyme, FUT2. Due to molecular mimicry by gut flora, individuals acquire “natural” antibodies (mainly immunoglobulin M [IgM]) to the antigen structure that they do not synthesize, which gives rise to transfusion incompatibility mediated by complement fixation by these antibodies. This process is analogous to the hyperacute rejection of xenotransplants seen in old world primates and humans due to their lack of a functional α(1-3)galactosyltransferase gene. Indeed ABO compatibility is crucial for successful organ transplantation in humans; hence, ABO antigens are now referred to as histo-blood group antigens.

The ABO transferase is evolutionarily old but acquired its polymorphic nature during mammalian evolution. The selective pressures that retain a balanced polymorphism are undefined, but their role in modulating the spread and pathogenesis of infectious disease has been postulated (and references therein). Bacteria and viruses often coat themselves in carbohydrate structures to mask their antigenic domains and ward off adaptive immune responses, as well as using oligosaccharide moieties as attachment sites. Notable examples are the enteric pathogens Norwalk-like caliciviruses and that use carbohydrate blood group antigens as cellular receptors on the gastric mucosa.

In this study we address the question of whether ABO antigens can be incorporated into the envelope of HIV-1. The surface envelope protein of HIV-1, glycoprotein 120 (gp120), is highly glycosylated, especially over the side of the molecule that faces outward from the virion after trimerization during assembly, protecting this area from neutralizing antibodies. Interestingly, analyses of viruses that escape from neutralizing antibodies often do so through repositioning of glycosylation sites in gp120. Although many of the -linked carbohydrate groups of gp120 are of the high mannose type, others have a mature structure, which can act as substrates for ABO transferases. The presence of -linked sugars on gp120 has been suggested to be dependent on the host cell (reviewed by Feizi). The lipid envelope of HIV derived from the host lymphocyte may also contain glycolipids as well as host cell glycoproteins such as major histocompatibility complex (MHC) class II and complement regulatory proteins.

Modification of viral glycosylation is known to render enveloped virions sensitive to natural antibody-mediated complement lysis. Retroviruses, lentiviruses, and rhabdoviruses raised in nonprimate mammalian cells incorporate α(1-3)galactoside moieties that sensitize them to human serum. Arendrup et al reported that HIV-1 IIIB derived from lymphocytes from an A donor could be neutralized by mouse monoclonal antibodies to the A antigen. Additionally, a recent study showed that measles virus grown in cells overexpressing ABO transferases is sensitive to human sera in an ABO-dependent manner. Incorporation of these antigens into HIV-1 particles may determine the relative risk of transmission between individuals of discordant blood groups. Recent studies have shown that the presence of natural antibodies can have a profound effect on the generation of cytotoxic T-cell responses against pathogens. Such innate immune responses against sugar structures on incoming viruses may also determine the speed at which the adaptive immune response against HIV is generated and thus help limit primary viral replication. We, therefore, sought to analyze the incorporation of ABO antigens into HIV-1 virions and their sensitivity to complement-mediated antibody-dependent inactivation.

Cell lines, lectins, and plasmids

293T cells were obtained from the American Tissue Culture Collection (ATCC, Manassas, VA). The glioma cell line NP2 expressing CD4 and CXC chemokine receptor 4 (CXCR4) or CC chemokine receptor 5 (CCR5) have been described elsewhere and were kindly provided by H. Hoshino. All cell lines were maintained in Dulbecco-modified Eagle Medium (Invitrogen, Paisley, United Kingdom) supplemented with 10% fetal calf serum (FCS) and 1000 U/mL penicillin and streptomycin. Fluorescein isothiocyanate (FITC)-conjugated and biotinylated lectins selective for blood group A , blood group B , the H antigen and α(1-3)-linked galactoside were obtained from Sigma, Poole, United Kingdom. Plasmid pSG encoding A and B transferases were kindly provided by F. Yamamoto, La Jolla, CA, and pcDNA encoding porcine α(1-3)αgalactosyltransferase was from C. Porter (Institute of Cancer Research, London, United Kingdom). The H transferase, FUT-1, was isolated from HeLa cells by reverse transcription-polymerase chain reaction and cloned into pBabe-Puro as a H1-R1 fragment using the primers GCGCGGATCCCGCCACCATGTGGCTCCGGAGCCAGTCG and GCGCGAATTCTCAAGGCTTAGCCAATGTCC. Lentiviral vector plasmids pCSGW (vector genome expressing enhanced green fluorescent protein [eGFP]) and p8.2 (HIV-1 packaging construct) were kindly provided by M. Collins, United Kingdom, and the HXB2 gp160 envelope expression vector pSVIII-HXB2 was obtained from P. Clapham, Worcester, MA.

Serum preparation

Fresh venous blood was drawn from healthy HIV-negative volunteers with informed consent (in accordance with the Declaration of Helsinki) and allowed to clot. We confirm that approval for the use of human serum from healthy volunteers was granted to Professor R. Weiss by the University College London Committee on Ethics (project ID 0335/001) in accordance with the Helsinki Protocol. Sera from ABO-defined donors were pooled and stored frozen until required. Total IgM was purified from serum using a HiTrap IgM purification column (Nycomed Amersham, Buckinghamshire, United Kingdom) as per the manufacturer's instructions.

Virus propagation

HIV-1 IIIB and SF2 are T-cell line-adapted X4 strains, SF162 is an R5 using primary isolate, 89.6 is a molecular clone derived from an R5 × 4 isolate, and 2028 and 2044 are low-passage primary isolates that use R5 × 4 and X4, respectively. Peripheral blood mononuclear cells (PBMCs) were prepared from ABO-defined donated buffy coats (National Blood Transfusion Service, Brentwood, United Kingdom) by Ficoll gradient centrifugation. Purified PBMCs were stimulated with 50 ng/mL phytohemagglutinin and cultured at 10 cells/mL in RPMI 1640/10% FCS or autologous human serum for 2 days. The cells were then split and cultured for a further 3 days in medium supplemented with 10 U/mL recombinant human interleukin 2 (Roche, Hertfordshire, United Kingdom). Cells (5 × 10) were then exposed to 1 × 10 focus-forming units (FFU) of HIV-1 stocks for 2 hours and cultured for 2 days. Infected cells were then cocultivated with fresh PBMCs and grown for a further 3 to 5 days. For cells cultured in autologous serum, fresh serum was added every 2 days. The cell supernatants were cleared by centrifugation and snap-frozen in liquid nitrogen. Titers were determined by serial dilution on NP2 cells expressing CD4 and the appropriate coreceptor and processed as described under “Serum sensitivity assays.”

Production of HIV-1 vector pseudotypes

Subconfluent monolayers of 293T cells on 10-cm plates were transfected with a total of 8 μg plasmid (pCSGW, p8.2, and pSVIII-HXB2 in weight ratio of 3:2:1) using Fugene-6 (Roche). For blood group incorporation, the cells were also cotransfected with pBabe-H, pSG-A, pSG-B, or pcDNA-α(1-3)α galactosyltransferase (GT). Viral supernatants were harvested 48 hours after transfection, filtered, and snap-frozen in liquid nitrogen. Viral titers were determined on NP2/CD4/CXCR4 by fluorescence-activated cell sorting (FACS) as described.

Serum sensitivity assays

Dilutions of fresh human sera were mixed with 200 FFU of each virus, and the serum concentration was adjusted to 10% with matched heat-inactivated serum, in OptiMEM (Invitrogen). The virus was then incubated at 37°C for 1 hour and plated on NP2 cells expressing CD4 and the appropriate coreceptor. After 2 hours of adsorption, the target cells were washed and cultured for a further 72 hours in fresh medium. The monolayers were then fixed in cold acetone/methanol (1:1 vol/vol) for 10 minutes and immunostained for in situ p24 expression as described previously. Titer was determined by counting infected foci by microscopy. Assays using guinea pig complement (Sigma) were performed by using reconstituted complement at 1:5. For assays using vectors, a multiplicity of infection (MOI) of 0.3 as determined on NP2 cells was used as input in the above assay. Virus infection was determined by eGFP expression by FACS 72 hours later.

Envelope Western blot

293T-produced vectors (10 mL) were pelleted by ultracentrifugation at 25 000 for 1 hour and resuspended in phosphate-buffered saline. A volume of 10 μL of each sample was separated on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel, transferred to an enhanced chemiluminescence (ECL) membrane (Amersham, Buckinghamshire, England), and blocked in tris-buffered saline (TBS) containing 5% bovine serum albumin (BSA) and 0.1% Tween-20. Glycosylated viral proteins were detected using ABO selective biotinylated lectins (10 μg/mL) and streptavidin-linked horseradish peroxidase (HRP). HIV-1 proteins were detected using a 1:2000 dilution of 3 sera from HIV-1-positive individuals and an HRP-linked rabbit anti-human polyclonal antibody. Visualization of the blots was by ECL reagent (Nycomed-Amersham).

Capture assay for gp120

A modified version of a gp120 capture enzyme-linked immunosorbent assay (ELISA) was used to detect ABO sugars on gp120. Virus was lysed in 0.5% empigen, and dilutions incubated on Maxisorb plates coated with a gp120 monoclonal antibody D7146 (National Institute for Biological Standards and Control [NIBSC], Hertfordshire, United Kingdom). Immobilized gp120 was then detected with either biotinylated ABO selective lectins or anti-HIV-1 human sera, followed by streptavidin-linked alkaline phosphate (AP; Nycomed Amersham) or AP linked to a goat anti-human polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA), and developed using the LumiPhos reagent. The relative luminescence was the read on a Lucy Luminometer (Rosys Anthos, Hombrechtikon, Austria).

Flow cytometry

ABO antigens were detected on cell surfaces using FITC-conjugated or (Sigma) at 5 μg/mL in phosphate-buffered saline (PBS) plus 5% BSA and 0.05% sodium azide. For blood group A, a mouse anti-A monoclonal IgG (Dako, Glostrup, Denmark) was used followed by a FITC-labeled goat anti-mouse polyclonal antibody. The cells were then analyzed on a FACScan (Becton Dickinson, San Jose, CA) using the Cellquest software.

ABO transferase expression in HIV-producing cells leads to histo-blood group antigens associated with gp120

The HIV-1 envelope proteins gp120 and gp41 are highly glycosylated during synthesis. Gp120 itself is both - and -glycosylated, especially on its outer face, an area known to exploit glycosylation for immune evasion. 293T cells were transfected with expression vectors encoding either A or B transferases in combination with the H transferase, or the mammalian α(1-3)galactosyltransferase, known to modify gp120 glycosylation, as a control. HIV-based vectors pseudotyped with the CXCR4-using gp120 HXB2 and packaging an eGFP reporter genome were raised in these cells in serum-free medium, and titers were established on the indicator cells, NP2/CD4/CXCR4, by FACS detection of GFP-positive cells. Cotransfection of ABO and H transferases had no effect on output viral infectivity with all titers between 4 and 5 × 10 IU/mL (not shown). A gp120 capture ELISA was modified to detect ABO sugars using A- or B-selective lectins. The HIV vector stocks were equalized by titer, detergent disrupted, and soluble gp120 was captured by immobilized antibody. Pooled human sera from HIV-1 individuals was used to detect the capture of gp120 and demonstrated that all stocks contained similar levels of the envelope protein ( All Out Ruffle Cropped Trousers Black N12H aQtE0
). The biotinylated A-selective lectin from was used to detect gp120-associated A antigen, with binding only detectable on envelope from A-transfected 293T cells. The B-selective lectin, , reacted strongly with envelope from B transfectants but not with A and O transfectants. The α(1-3)Gal (galactosyl) lectin reacted both against virus from α(1-3)αGalT (galactosyltransferase) and B-transfected cells. While these lectins can bind to other carbohydrate antigens (eg, the Ty antigen for ), the reactivity for a particular lectin for gp120 was dependent on the transfection of the specific ABO glycosyltransferase.

These results indicated that ABO transferases add blood group antigens to gp120. Pelleted virions from transfected cells were lysed, and viral proteins were separated by SDS-PAGE and detected by Western blot with lectins or serum from an HIV-1-infected individual. Virus produced from A-expressing cells yielded a band of 120 kDa with the whereas gave 120-kDa bands in the B and α(1-3)αGalT transfectants. The total gp120 loading was equal in all lanes, and the lectin bands were dependent on specific transfection with viral components ( Figure 1B ). Thus, in cells expressing ABO transferases, HIV-1 gp120 can be modified to carry blood group moieties.

The mammalian α(1-3)αGalT when expressed in human cells modifies the glycosylation of lentiviral envelope proteins, and virions become sensitive to complement fixation by natural antibodies in human serum. Floral Shift Dress With Sleeve Rib Detail Black flower YAS pIUAc
To see whether the same was true of human ABO transferases, the HIV vector stocks were assessed for sensitivity to human sera from ABO-defined donors. A volume of 2 × 10 4 IU of vector (MOI of 0.3) was incubated with 10% or 1% active human serum diluted in matched heat-inactivated serum. Serum sensitivity was expressed as the percentage of GFP-positive NP2 cells compared with virus incubated in 10% heat-inactivated serum ( Floral Patch Slim Leg Jeans Blue Evidnt 0ozTtoV
). O vectors (those produced only in the presence of the H transferase) were not sensitive to inactivation in any sera. Vector raised in cells cotransfected with the A transferase was partially sensitive to inactivation by sera from O and B donors but not in A serum. Conversely, vector raised in B transfectants was partially sensitive in O and A sera but not in B serum. To control for variation in complement in donor sera, vector raised in α(1-3)αGalT-transfected cells was tested for human serum sensitivity, which, as expected, was equally sensitive in all sera. These results indicate that expression of ABO transferases in HIV-1-producing cells sensitizes virus to human complement-mediated inactivation in a manner consistent with the incorporation of ABO antigens into the virion.

It's not just a landmark, it's a destination.

Trousers in 100 new milled wool Uta Raasch black Uta Raasch GwLWLHQQ
E-News
/ April 120 sandals Nude amp; Neutrals Jimmy Choo London h1ZIdrSY
/ Artbeat Presents New Shanghai Circus – Acrobats of China

Astonishing athletes defy gravity and execute breathtaking feats as they stretch the limits of human ability in this spellbinding show. Fearless performers with boundless energy bring you more than two thousand years of Chinese circus traditions. If it’s humanly possible – and even if it’s not! – Shanghai’s acrobats, jugglers and contortionists do it with spectacular flair.

Each year New Shanghai Circus adds new performers direct from leading Chinese circus schools, creating a revolving line-up of award-winning favorites like , , , , , and .

In 1999 New Shanghai Circus became the first Chinese acrobatic troupe to perform on Broadway and were named ‘Best Foreign Production on Broadway.’

Chinese acrobatic tradition dates back to 700 B.C.; that’s over 2,000 years of tumbling, balancing and juggling. Ancient stone carvings, earthen pottery and early written work trace the ancestry of today’s spectacular acts.

The art of Chinese acrobatics developed out of the Lunar New Year harvest celebrations, where the village’s peasants and craftsmen would hold a kind of Chinese Thanksgiving. Acrobats would use household tools and common items found around the farm and workshop as part of their exciting feats.

‘The talents of the Shanghai acrobats are beyond compare…watch these acrobats and be stunned and thrilled.’ –

‘Show-stopping rarities of daunting difficulty’ –

‘Fantastic’ –

‘The show is a beautifully orchestrated presentation of Chinese circus acts dating back to harvest festivals of 2000 years ago. This modern day performance is enhanced by fabulous choreography, amazing lighting, enchanting scenery, and powerful music.

Audience members are enthralled by astounding contortionists, masterful acrobats, and clever comedians. They see feats of incredible skill and imagination. They gasp at many of the gravity-defying feats and applaud at the the super-human displays of power and extraordinary grace.’ –

ADA ACCESSIBLE SEATING INFORMATION If you require ADA accessible seating, tell Ticket Agent at the beginning of the transaction; online, select from the ADA Accessible section. All ADA Accessible seating is Reserved Seating with specific Row and Seat Number designations on the tickets.

What the Press says about New Shanghai Circus: All seating areas in the Theatre other than the ADA Accessible seating area [Orchestra Row X] require a minimum of 8 stairs to access; there is no elevator.

Face Value Ticket Prices

Orchestra $49.50 / $39.50 Terrace $49.50 / $39.50 Balcony $39.50 / $29.50 / $19.50

SMART Recovery® gratefully appreciates the support of the following organizations:

“Discover the Power of Choice!”™

SMART Recovery is the leading self-empowering addiction recovery support group. Our participants learn tools for addiction recovery based on the latest scientific research and participate in a world-wide community which includes free, self-empowering, science-based mutual help groups.

Quick Links

Donate

Contact Us

7304 Mentor Avenue Suite F Mentor, OH 44060 Toll free: 866-951-5357 Tel: 440-951-5357 Fax: 440-951-5358 Send A Message

Created By: SMART Recovery | Copyright 2018 | Privacy Policy | Terms of Service